circad | circRNAs associated with diseases

circRNA SKIL
Gene	SKIL	Organism	Human
Genome Locus	chr3:170359698-170361429:+	Build	hg19
Disease	PDLSC osteogenis	ICD-10	Gingivitis and periodontal diseases (K05)
DBLink	Link to database	PMID	29197342
Experimental Method
Sample Type	Periodontal Ligament Stem Cells (PDLSCs)	Comparison	Periodontal Ligament Stem Cells (PDLSCs) with and without dexamethasone and Vitamin-C induction
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward AGGAGAAGTTTAGCATGAGAAGTG Reverse AATTGCCCAGTTATCTTCAAGGATT	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Gu, X, Li, M, Jin, Y, Liu, D, Wei, F (2017). Identification and integrated analysis of differentially expressed lncRNAs and circRNAs reveal the potential ceRNA networks during PDLSC osteogenic differentiation. BMC Genet., 18, 1:100.